logo

 CRISPR guideRNA design and analysis

About


gRNA Design Tool

The gRNA design tool provides the least processed interface to the Guidescan2 backend. It takes as input a genomic interval and responds with all gRNAs within that genomic region that have been vetted and annotated by Guidescan2. The output is displayed both in an IGV browser and a tabular format available for download. Due to the density of gRNAs in most genomes, the output for even a small genomic region may have many guides. Do not be concerned if the output seems rather large.

Textbox Input Format

Genomic intervals are line delimited and can take three forms. Namely, Guidescan2 understands the coordinate syntax "chrX:start-end", gene symbols (case sensitive), and Entrez GeneIDs. The chromosome must be appropriate for the organism of interest.

For example, one can find gRNAs for 5 loci as follows:

chr4:312000-315000
chr4:313000-317000
chr4:315000-319000
VEGFA
7422


Notice that VEFGA and 7422 are the same region (see: here).

Alternatively, one can submit a DNA-sequence. This will first find the location of the sequence within the genome of interest and then find all gRNAs within that sequence. Exact matches are required, so if a different reference is used, it is not guarenteed that matches are found.

For example, an input might look like this:

ATCAGCGATCGACTAGCGCGCGCGCTAAAAAAAAAAA
CACATCTCTCTTAGGGGGAANACTAGGGGGGGGGGAA
ACACACAGCCCCCCCCCCCCCCACAGGTTTTAACGAG
ACATAGGGGGATACAGCGACGGGGGGGGGAGCGACAT

Line breaks are allowed within the input, but only one DNA-sequence can be submitted at a time due to the computational resources required for alignment.

File Upload Format

One can upload their query a BED file, GFF/GTF file, or TXT file to be processsed. Standard BED and GTF formats are expected. For a TXT file, the site expects a file composed of a single column of genomic coordinates of the form chrX:start-end just as in the textbox input. This TXT file should have one genomic coordinate per line. Note that Guidescan2 expects standard file extensions (i.e. .txt/.bed/.gff/.gtf) for file uploads.

The exact specificiations used for BED and GFF/GTF files are from the following places:

We provide working examples where we use the same regions across all examples for clarity.

Example of a valid TXT file upload:

chr4:312000-320000
chr4:312000-313000
chr4:312000-315000

Example of a valid BED file upload:

chr4 312000 320000 chr_4_example_1 0 +
chr4 312000 313000 chr_4_example_2 0 +
chr4 312000 315000 chr_4_example_3 0 +

Example of a valid GFF/GTF file upload:

chr4 example_1 interval 312000 320000 . + . .
chr4 example_2 interval 312000 313000 . + . .
chr4 example_3 interval 312000 315000 . + . .


Gene-targeting Library

GuideScan2 analysis identified widespread confounding effects of low-specificity gRNAs in published CRISPR knockout, interference and activation screens and enabled construction of a ready-to-use gRNA library that reduced off-target effects in a novel gene essentiality screen. The screen design tool provides an interface to design CRISPR screens using this library. Complete details for the Guidescan2 libraries can be found in our paper.

Textbox Input Format

The Guidescan2 libraries, and thus the screen design tool, work at the gene level. Genes should be input in a line delimited format as in the gRNA design tool. The key difference here, however, is that arbitrary genomic intervals are not accepted. Genes input are case sensitive and if a gene is not found, it will be reported to you in the output.

Parameters

The important configuration parameters for the tool are the number of gRNAs per gene and the percentage of control gRNAs. The Guidescan2 library covers each gene with six gRNAs, but we allow the user to reduce this number as necessary. The Guidescan2 library contains two types of control gRNAs, non-targeting and safe-targeting, which are described in our paper. When designing a screen, we allow users to specify the percentage of control guides as a fraction of the total library size. Similarly, we allow users to select a random set of essential genes to include in their screen as a fraction of the total library size.


The gRNA search tool offers the ability to search for gRNAs in the Guidescan2 databases directly by their sequence. Importantly, we note that this is not equivalent to searching the sequence directly against the Guidescan2 indices as this database has already filtered gRNAs with multiple perfect matches. Unfortunately due to resource constraints we could not offer this feature on our website, but it is offered in the command line version of our tool. The tool requires that the gRNAs nearly perfectly match that found in the database. Thus if a gRNA is not returned by the search it could mean that either it is not a match in the database or that it was filtered out by Guidescan2.

Citation

Schmidt, H., Zhang, M., Chakarov, D. et al.
Genome-wide CRISPR guide RNA design and specificity analysis with GuideScan2. Genome Biol 26, 41 (2025).
https://doi.org/10.1186/s13059-025-03488-8


Perez, A., Pritykin, Y., Vidigal, J. et al.
GuideScan software for improved single and paired CRISPR guide RNA design. Nat Biotechnol 35, 347–349 (2017).
https://doi.org/10.1038/nbt.3804